hiiiinjbhug hiiiinjbhug

25-03-2021
Social Studies

contestada

What very short section of the wall is not dated?

Respuesta :

DRAGONKING125 DRAGONKING125

25-03-2021

Answer:

The Bei Qi kingdom (550–577) built or repaired more than 900 miles of wall, and the short-lived but effective Sui Dynasty (581–618) repaired and extended the Great Wall of China a number of times.

Explanation:

Answer Link

Otras preguntas

You own an oil pipeline which will generate $2 million cash return over the coming year. The pipeline’s operating costs are negligible, and it is expected to la

PLEASEEEE HELPPPPP! :,,|

2 (6z + 2) = 28 Linear equations w/ distributions. Please

ter 1: Solving Simple Equation Solve x +5 = 8.

Data clusters are sets of signs or symptoms that are grouped together logically. Match each sign or symptom with its appropriate data cluster category. (A) Res

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

What is -.36 in m/n forms simplify

Consider the relationship between the words motorcycle and vehicle. Which answer choice contains a pair of words with the same relationship? instrument: hammer

If you were the President of United States, what issue/problem would you address and try to fix first? Explain why this issue/problem is more important than oth

Donna has observed that her father can control the speed of their grandfather clock by adjusting the height of the weight on the end of the pendulum. Donna thin