montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

What were the benefits and costs of declaring independence?

which continent include the coordinates of 30°S latitude, 135°E longitude?

what decimal is between 1.5 and 1.7

How could an equal balance of power between the two parties in Congress be achieved?

Read the statement, and identify the expressions that are equivalent. the sum of a number times 3 and 15 A.15 + 3n B. (n + 15) × 3 C.15 + 3 × n

why was the development of Sanskrit important to making the Vedas last

Describe the role of a decomposer in a food web.

Each person, regardless of age or backgrounds, have the right to krump. How should the sentence above be rewritten to correct the subject-verb agreement error?

~PLEASE HELP~ *Dealing with ratios*

~PLEASE HELP~ *Dealing with ratios*