croitru7857 croitru7857
  • 25-02-2018
  • Biology
contestada

The base sequence of the template strand of dna is cattggtaggcaaaagaact. what is the new synthesized complementary strand?

Respuesta :

Eric0422 Eric0422
  • 25-02-2018
gtaaccatccgttttcttga
Answer Link

Otras preguntas

What was vomitorium used for?
Q2. In a 4x100 m relay race, total track length is 200m and time taken by one particular group is 50.2 s. What is the average speed and average velocity of that
show that at least 3 of any 25 days chosen must fall in the same month of the year.please halp!
what are the main voice types in singing?
Which of the following is true regards to the Navigation Acts by the 18th century
Which of the following is true regards to the Navigation Acts by the 18th century
solve the problem by using mathematical sentence and solve then label your answer.A province produced 2,543,475 metric tons of sugarcane in 2003, and 4,905,369
Which of the following is not equivalent to the formula d = rt?
Multiply and simplify.(a - 2b) (2a - b) (a + 2b)
1. In a certain county, the number of Charter Schools is eleven less than twice the number of Alternative Schools. There are 35 Charter Schools in the county. W