kemajones1982oz5r7t kemajones1982oz5r7t

25-01-2018
Chemistry

contestada

the distance between the resting point and the crest of a transverse wave is called the? WILL GIVE BRAINLIEST

Respuesta :

lilsmitty137ovf7yw lilsmitty137ovf7yw

05-02-2019

amplitude is the correct answer

Answer Link

mickeymousenatural mickeymousenatural

08-04-2021

Answer:

Amplitude

Explanation:

Answer Link

Otras preguntas

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

What does it mean to cross-reference information

who was the founder of delawaer

How are you going to overcome these differences and create strong, unified nations?

function of nucleus, mitochondria ,endoplasmic reticulum, vacuoles

pargraph about movie review

1.(01.01) Evaluate -6 - (-1). (1 point) 5 -5 6

3. Which of the following statements about exergonic (energy releasing) reactions is NOT true? a. They release energy b. Glucose metabolism is an example c. The

Each day, the Royal Chocolate Master puts all of the candies he makes in boxes with the same number of candies in each box. Today the Queen wants him to put 30

Miriam has 3 packages of pencils. Each package has 6 pencils. She needs an eraser for each pencil. How many erasers will she need to buy? Tell which OPERATIONS