carinrenee14
carinrenee14 carinrenee14
  • 21-11-2017
  • History
contestada

How did new knowledge, based on Aristotle and other Greek thinkers, pose a challenge to Christian scholars?

Respuesta :

hannahl52
hannahl52 hannahl52
  • 24-11-2017
Aristotle and other Greek thinkers based knowledge on rational thinking, logic, and natural wisdom vs the religious perspective of a Christian scholar. This was challenging because natural laws of life exist inspite of a person's belief of God as the highest deity.

please vote my answer brainliest. thanks!
Answer Link

Otras preguntas

Chloe’s mother wants to have another child. However, she is concerned that a second child might also have CF, so she encourages Chloe’s stepfather to be tested.
I need somebody's help..
which of the following expressions is equal to 1? a. 5^0 x 6^-3 x 6^3 x 5^1 b. 5^2 x 6^-2 x 6^3 x 5^-3 c. 5^2 x 5^-2 x 6^0 x 6^2 d. 5^-1 x 6^5 x 6^-5 x 5
Tensile strength of a wound is directly related to the
87.5 of what number is 315
1.True or false: It may be possible to save a significant proportion of Earth's biological diversity by establishing sustainable biological reserves at 25 locat
Do any of these represent a linear function (just state letters if they do)
Does old age means end of life according to A Tennyson in Ulysses
If someone was born with Jacob’s syndrome (XYY), in which parent and when nondisjunction happened during gamete formation?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC