coolgirl13 coolgirl13
  • 24-10-2015
  • Mathematics
contestada

How many times does six go into forty-eight?

Respuesta :

Percy2Chase
Percy2Chase Percy2Chase
  • 24-10-2015
6 x 8 = 48, the answer is 8, just divide 48 by 6.
Answer Link

Otras preguntas

A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you
Elaine bought a total of 15 shirts and pairs of pants. She bought 7 more shirts than pants. How many of each did she buy?
what is the main point being made by the cartoonist documeny E
Pseudomonas syringae is found naturally in the soil. Sold as Snomax, it is used to make snow at ski resorts. The same bacterium with a gene deletion (Ice-minus)
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what is the credit card balance? A-The amount of interest you must pay the credit card company. B-The required minimum payment to your credit card company. C-A
the combined land area of the countries A and B is 147,973 square kilometers. Country A is larger by 673 square kilometers. Determine the land area of each coun
how did Thomas Edison contribute to the Industrial Revolution
Circle the preposition in these sentences We were exhausted because our flight arrived at 4am.
How do short-term goals differ from long-term goals?