erickaz1982 erickaz1982
  • 23-10-2017
  • Biology
contestada

The DNA sequence TTG is changed to TCG and produces a new protein. Which type of mutation is this?

Respuesta :

Diana187
Diana187 Diana187
  • 23-10-2017
The answer is Missense. The amino acid is being replaced by another amino acid in the DNA sequence TTG changing to TCG and producing a new protein.
Answer Link
saadhussain514
saadhussain514 saadhussain514
  • 29-09-2018

Answer:

A. Missense.

Explanation:

Since the resulting nucleotide is offset from its initial sequence by only one parallel nucleotide we can definitely say it is Missense mutation. This sort of a mutation is known as a nonsynonymous mutation, there is only one direct substitution that occurs in the codon producing a different amino acid.

Answer Link

Otras preguntas

Need help as soon as possible
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
What does the force of gravity do for us?
Which of these graphs represents a function ?
As part of a daily workout program. Participants must do lunges along the length of a pool, swim the diagonal of the pool, and then jump rope the width of the p
Can anyone tell me part B? What’s the 6th term!? Will mark brainliest!
Please help ggdskdsrjcxseyhcdijb​
Help again ASAP! (No links)....
Josh is playing laser tag with his friends. For his group, there is a $10 flat fee and an additional $6 fee per person. He pays $28. How many people were playin
I need help with the question that is attached.