delianjackson926 delianjackson926

23-02-2024
Mathematics

contestada

A soccer field is 105 meters long. A football field is 120 yards long. Which is longer?

Respuesta :

jaxmlne jaxmlne

23-02-2024

meters because every meter contains 3 yrads

Answer Link

Otras preguntas

In a Worn path by Eudora welty in lines 1-9 what details suggest that phoenix is in for a long journey?

What role does the media play in reporting human rights violations in the right manner

Sound travels at a rate of 340 m/s in all directions through air. Matt rings a very loud bell at one location, and Steve hears it some time later at his locatio

a water sample could be negative for enterococcus and coliforms and still be a major public health threat. why? Why can filitration be used to sterilize culture

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Please help me with this Imma on a time limit

a solution of 0.10 hydrochloric acid, HCL is a better conductor of electricity than 0.10 M acetic acid, CH3COOH. sketch the ions and molecules in both solutions

Jonathan has a collection of 400 marbles. Blue marbles make up 17%, percent of his collection. How many blue marbles does Jonathan have?

What did Anti-Federalists fear would happen if the Constitution became law?

Nathan is buying a cell phone for his business. The regular price of the cell phone is $179. If he buys the phone in the next 2 weeks, he will get a 20% discoun