harsh005959
harsh005959 harsh005959
  • 26-05-2017
  • Computers and Technology
contestada

Why would an IT technician ever have to change out a computer’s motherboard?

Respuesta :

StayPuftMarshadowMan
StayPuftMarshadowMan StayPuftMarshadowMan
  • 26-05-2017
Here are a couple reasons:
Integrated Ports Gone Bad.
Motherboard is fried from electrical charge.
New features of updates.
Hope this helps.
Answer Link
supermanvscell
supermanvscell supermanvscell
  • 09-10-2019

Answer:

If the Motherboard was shorted out, you would need to change it out then.

If the Capacitor is shorted or it is leaking out acid, if you can't repair it you would then need to replace it.

If the Motherboard itself is cracked.

Dust and debris can make the Motherboard stop working.

If the CPU has fried the motherboard with a max output.  

Explanation:

Answer Link

Otras preguntas

why can't the position of an electron be determined with certainty?
Emily buys 4pens for £1 how much would 7 pens cost ?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what is similarities and differences freedmen and serfs?
Which of the following statements is true? a.People rarely adapt to stress over time. b.Stress is inevitable c.Most people would rather have their stresses of t
How are glial cells and neurons alike and how are they different. Give 3 sentences for each
how to solve these questions?
The tube that connects the bladder and the outside is called the
What is the most common cause of liver failure ?
What's x² + 2x + 1 factorised?