basic201
basic201 basic201
  • 26-04-2017
  • Mathematics
contestada

Round each number to the nearest tenth. What is the best estimate for the answer to 723.38 + 41.21? A. 765 B. 764.6 C. 764.5 D. 760

Respuesta :

lemonader
lemonader lemonader
  • 26-04-2017
Your answer is...
764.6 (B)
Answer Link
maya47 maya47
  • 26-04-2017
B. Would be the answer
Answer Link

Otras preguntas

DNA tacaggtacccgaacccaattta
Which of these BEST describes the significance of the Emancipation Proclamation? A: It allowed slavery to remain the same in states who already used slave labor
Please help I have a lot more
What is the value of x?
please help and explain
The human population has grown exponentially due to all of the following factors except _____. advances of technology evolution of new diseases expansio
the smallest particle an element can be divided into into is the
IM ON A TIMER! PLZZZ HELP Read the excerpt from Emily Dickinson’s “I’m Nobody! Who Are You?” Which two lines have a rhyming pattern? How dreary—to be—Somebo
at the highest price you would expect the demand for service goods and service to be the
What is the intersection of the sets D={5,7,10,13,19}and E={3,7,14,19} A.{7,19} B.{5,7,9,10,13,14,19} C.{5,9,14} D.null set