ZorlocYT
ZorlocYT ZorlocYT
  • 22-03-2017
  • Mathematics
contestada

Pls help me guys! This is super hard!

Pls help me guys This is super hard class=

Respuesta :

k411 k411
  • 22-03-2017
I'm not sure but is it about height x length x weight?
Answer Link

Otras preguntas

The chorionic villi of the placenta develop a series of capillaries that are immersed in lacunae of the mother's blood for exchange into the embryo's blood duri
what the decimal of 2 1/4
When parietal cells secrete protons into the stomach, what would you predict would happen to the pH of the blood? Would this process be affected if you treated
of the 600 workers at a factory, 8.5% belong to a union. how many workers are in the Union?
Instructions:Select the correct answer. Read the following excerpt from the poem “On Imagination” by Phillis Wheatley .Imagination! who can sing thy force?Or w
Your grandma thinks that the theory of evolution can't be possible because she has never seen a monkey turn into a human. How could you convince her otherwise?
Who discovered polio vaccine
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
A population consists of 300 individuals where 58 of them are homozygous for the red color allele (A) and 120 of them are homozygous for the blue color allele (
Find the mean of these values 6,4,8,2,5