Seudónimo Seudónimo

24-02-2017
Mathematics

contestada

Can someone please help me out with this I'm stuck

Can someone please help me out with this Im stuck class=

Respuesta :

emivorreilli emivorreilli

24-02-2017

A=[tex] x^{2} [/tex]
P=4x

That's the simplest form you can write the area and perimeter of the square in.

Answer Link

Otras preguntas

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Why do South Americans holds a larger celebration on december 24th than 25th?

Tumors can be really serious because they can cause what in the body? A. uneasiness B. pressure C. discomfort

Paying people more when they contribute more increases motivation, which in turn leads to high performance. TRUE/FALSE

what is not an characteristic that is considered to be part of excellent discussion contributions?

the magical revolution of the reincarnated princess and the genius young lady anime

A two-part question.... (i). Set up, but do not evaluate, a triple integral that gives the volume of the right circular cylinder enclosed by the surfaces x^2 +

FILL IN THE BLANK. blood pressure is highest in the ___________ and lowest in the _____________.

Based on the following statements, which European policy is described? Colonies are required to provide raw materials. Development of manufacturing in the colon

which group used a document called common sense to persuade people to join its cause? (3 points)alliesloyalistspatriotsundecideds