adajesus adajesus
  • 22-02-2017
  • Mathematics
contestada

-2x+6<4 or 7x+1<-13 what is the answer

Respuesta :

Ahmadhabib98
Ahmadhabib98 Ahmadhabib98
  • 22-02-2017
i guess x<1 and x<-2

Answer Link
Gabbycvh123
Gabbycvh123 Gabbycvh123
  • 22-02-2017
x>1x<−2
because of the OR this would be your answer
Answer Link

Otras preguntas

A trader by mistake calculates the profit on the selling price and accounts it as 25% find the correct profit earned by the trader
I need some help with this
24/34 Marks Write the missing numbers in this multiplication grid. X 8 -4 6 4 48 20
5. What is the Ribbon? A. A string of code that enables XML compatibility. B. The path name that refers to where a command is located in the program. C. Another
Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:
Given quadrilateral ABCD is a rhombus, find x and m
Help with biomass worksheet, thank you so much!
They looked like little flags floating everywhere. "" Here the narrator implies
What was the Persian Gulf War? How did the war help lead to the events of 9/11?
12. Which informational subject would benefit the most from a line graph? O A. A step-by-step process O B. Profits throughout the past 18 months O C. Total amou