TestUser5
TestUser5 TestUser5
  • 24-01-2017
  • Physics
contestada

When we will see Halley's Comet again ?

Respuesta :

martyntest16
martyntest16 martyntest16
  • 24-01-2017
We will see it again in 28 July 2061.
Answer Link
Аноним Аноним
  • 24-01-2017
Hailey's Comet comes in around 75 - 76 years. It will next appear in the night sky in the year of 2062

Hope this helps!
Answer Link

Otras preguntas

what is the solution of the following question? x^2+10x+25=12
what does hafa adai mean in guamanian
Use these words in a sentence proton neutron and isotope
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What does 28 tens equal to
How can global warming lead to changes to the Earth’s surface? a. Global warming can lead to an increased number of earthquakes, which change the Earth’s surfac
5. udents are asked to compare the layers of the Earth to the layers of the Sun and draw a model of each Earth's Layers mantle outer core inner core Sun's Layer
Prolonged use of antipsychotics may lead to ______ in adults..... extrapyramidal effects and tardive dyskinesia parkinsonism-like symptoms neither a or b both a
A major cause for gender inequality is believed to be (Points : 1) economic division of labor by gender. political leadership. women’
which of the following is a general way to describe the base pairing rules for DNA