dadonreeree dadonreeree

22-07-2021
English

contestada

What is the key word in the sentence?
When you make a mistake, don't be abashed.
O Mistake
O When
O Make
Abashed

Respuesta :

22-07-2021

Answer:

Mistake

Explanation:

Mistake is the Keyword because if you wouldn't have made a mistake in the first place you wouldn't be abashed in the first place. Abashed is another word for embarrassed/ashamed.

Answer Link

marcialtorres1022 marcialtorres1022

22-07-2021

Mistake would be your answer

Answer Link

Otras preguntas

the expression 4X gives the perimeter of a square with a side length of X units. what is the perimeter of a square with a side length of 5/7 units?

Can anyone help? My teacher just briefly went over this in notes and I can't really decipher between physical and chemical changes in the examples

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

blank thousands equals 1800 tens

state one reason of magazines has negative impact on individual right in a democratic society

what is 7/8ths of 40

Kohlberg believed that human moral development is strongly based on the fact that we all have a desire for justice and a(n) __________. A. impartiality for fair

During a cesarean section, an incision is made through all EXCEPT which of the following? A)linea alba B)perimetrium C)superficial fascia D)decidua basalis

Solve y=5x-8 and y=6x+3 by elimination

what does the root word boton mean