24-04-2021
Mathematics

contestada

A circle has diameter of 17 meters. What is its radius?

This is Delta Math

Respuesta :

bigtankotron bigtankotron

24-04-2021

The radius is 8.5. It is just the diameter cut in half btw for any future questions.

Answer Link

Otras preguntas

I will mark brainly, help me with this question please.

A scale drawing for a rectangular parking lot measures 5.3 cm by 7.5 cm. The scale is 2 cm:7 m. What are the width of the actual parking lot, if the drawing wid

plss help me with this:(((

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

In which sentence is the adverb clause punctuated correctly? A. After he played and won the soccer game, he went to eat dinner. B. He went to eat dinner, after

Mike makes and sells skateboards. If he has a cost of $6,200 per year plus a cost of $15 per skateboard, how many skateboards must he sell in order to make a pr

How can I master networking my home/business computer(s) - Tv's - iot devices and make the whole system as secure as possible?

WILL GIVE BRAINLIEST

In an investigation that uses the scientific method, which step immediately follows making a hypothesis? summarizing the results asking a question making observ

Job bakes 48 cupcakes and 60 cookies. What is the biggest number of cupcakes and cookies that can be placed in boxes if these are of the same number? pls answer