valenjudieavinel valenjudieavinel

23-04-2021
History

contestada

Which of these idees MUST be included in a summary of the speech?

Which of these idees MUST be included in a summary of the speech class=

Respuesta :

lucasmcnamara lucasmcnamara

26-04-2021

Answer:

c i think but i dont know man

Explanation:

Answer Link

Otras preguntas

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Which of the following was not true of serfs? Serfs were valuable sources of labor to their landlords. Some serfs had their own small farms, where they gre

1. A store advertises 15% off an item that regularly sells for $300. A. What is the sale price of the item? Answer: $255 B. How is a 15% discount similar to a

4. How many molecules are equal to 2.25 moles of sulfur dioxide?

Mrs. otsuki wanted to lose weight. she told her therapist that all her previous attempts seemed to get mysteriously stalled, in spite of her strong motivation.

How are the areas of polygons used to find the surface area formulas for three dimensional figures?

1. A store advertises 15% off an item that regularly sells for $300. A. What is the sale price of the item? Answer: $255 B. How is a 15% discount similar to a

Ill is concerned about tim's self-esteem. tim's attitudes about himself have begun affecting his work. tim is just consumed with the fear of failure. he keeps t

I need to know what this says

What’s the answer to this