loliva93 loliva93
  • 22-04-2021
  • Mathematics
contestada

Sandy buys school supplies at Walmart that costs $27.97. How much will she spend if she uses a 10% off coupon? Round to the nearest hundredth.

Respuesta :

ang832 ang832
  • 22-04-2021
10% off of 27.97 is 25.17
Answer Link

Otras preguntas

I’am not sure what to think of this one please need help
What is the variance?
Use the graph to complete the input-output table. List the answer in the format of (x, y). A) 1, 4 B) 2, 2 C) 2, 3 D) 2, 5
During cellular respiration, energy is stored in the form of _______. A. food B. oxygen C. ATP D. water
What is the answer to 3 1/2r=28
Anthony will be competing in a body building competition in 12 months. He initially weighs 160 pounds and by the end of 12 months weighs 232 pounds. What is the
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
Jeremy is doing a project.He needs pieces of wood that are 4 inches long.The store sells wood only in pieces that are in 1 foot long........
What is the theme of this poem by Langston Hughes? "Still Here" A. suffering B. death C. stamina D. defiance
give three examples of stimuli that your sensory receptors are responding to right now