arwaokab5 arwaokab5
  • 22-04-2021
  • Spanish
contestada

How to say la mesa pequeña plural.
Answerrr!! Hurry!!!

Respuesta :

samaroocrisel
samaroocrisel samaroocrisel
  • 22-04-2021
The plural form of las Mesa pequeña is Las mesas pequeñas
Answer Link
vnsxza vnsxza
  • 22-04-2021
las mesas pequeñas is the plural
Answer Link

Otras preguntas

Why did the Aztecs engage in human sacrifice?
What’s the answer???(SOMEONE PLEASE HELP)
What best explains the beginning of slavery in Virginia?
Solve 60 = 10√ y – 3
which is not used to describe a population of grizzly bears in canada a) demographic history b) geographic distribution c) overall growth rate d)population
what were conditions like on the middle passage for the slaves
What phrase best defines a star system? a group of hundreds of stars a group of two or more stars a group of stars that formed around the same time a group of
avery had $32.20 in her wallet. If she bought lunch with 6 ¼ dollars from her wallet, how much money did she have in her wallet after lunch?
DNA tacaggtacccgaacccaattta
How did Saudi Arabia transform itself from an ancient desert kingdom to a modern country in just one generation? A. by suppressing political opposition to the c