lyndalyndalynda lyndalyndalynda

26-02-2021
Mathematics

contestada

What is the median of the ages in this stem-and-leaf plot?

43

45

46

47
brain for the right answer

What is the median of the ages in this stemandleaf plot 43 45 46 47 brain for the right answer class=

Respuesta :

Ladybug11g Ladybug11g

26-02-2021

Answer:

46

Step-by-step explanation:

4 is in the middle then you go to the side which is uneven. 5 and 7 arein the middle. you add them which equals 12 and divide by two. which equals 26.

Answer Link

AutumnElkinsLepper AutumnElkinsLepper

13-05-2021

Answer:

its actaully 45

Step-by-step explanation:

Answer Link

Otras preguntas

10(x+3)=9 mmmmmmmmmmmmmmmmm

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

how could you use division to find out how many whole pies are in 11/3 of a pie? explain!!!!!!

if you are given a 2% raise and inflation rate is 3% you are

. A ski club planned a trip to Lake Tahoe, and 40 of the members signed up to go. If this is 60% of the club, how many members does the ski club have in total

write a sentence with the word labyrinth

what number must you add to the polynomial below to complete the square? x^2-x A. 1/4 B. 1/2 C. 2 D. 1

The height in inches of three boys is 54.0 48.5 46.0 respectively the height of the 4th boy is denoted by h inches the average height a of the 4 boys can be exp

How many cm has a inch

write a sentence using the words limiting factor and carrying capacity