uriostjo
uriostjo uriostjo
  • 25-02-2021
  • Mathematics
contestada

image is down below :)

image is down below class=

Respuesta :

Аноним Аноним
  • 25-02-2021

Answer:

(-5,3)

Step-by-step explanation:

It forms a straigth line, forming a 90 degree angle with the x-axis.

Answer Link
768360 768360
  • 25-02-2021

Answer:

(-5,3)

Step-by-step explanation:

Answer Link

Otras preguntas

Consider the following piecewise-defined function. f(x){x^2 -5, x<3
A major cause for gender inequality is believed to be (Points : 1) economic division of labor by gender. political leadership. women’
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
physical components are connected to a cpu via the motherboard in all the following ways except
the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch
if a neuron had a mutation that prevented the production of voltage gated Na+ channels, what function would the neuron NOT be able to accomplish?
.Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. A link to a table of codons can be found here
what do you think accounts for algerias score it has received in recent years on government stability and the absence of violence
Factor polynomial: 5x^2+21x+4=0
15% of 6758 for fun. lets see if you can answer this