MelanieAlvarez67889 MelanieAlvarez67889
  • 25-02-2021
  • Mathematics
contestada

Determine if the two figures are congruent by using transformations

Determine if the two figures are congruent by using transformations class=

Respuesta :

nyla2484
nyla2484 nyla2484
  • 25-02-2021
I think it’s A, sorry of I’m wrong
Answer Link
2ptnsmjv4t
2ptnsmjv4t 2ptnsmjv4t
  • 25-02-2021
d. is the answer (if it helps, try drawing this stuff on a graph).
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Helpp Pleasee ASAPPPPP
Compare and contrast immune tolerance with licensing
What domain did sues rule?
in dogs, wire hair (S) is dominant to smooth (s). Cross of a homozygous wire-haired dog with a smooth-haired dog and show the genotypic and phenotypic ratios.
Which best describes the climax of the Odyssey? A. Odysseus kisses the ground as his journey home comes to an end. B. Odysseus sees Telemachus for the fir
one reason President Johnson created the Great Society program was to
Lexington County Army Air Base in Columbia South Carolina bears the distinction of being one of the training sites for A) the Tuskegee Airmen. B) Doolittle
What name was given to the Allied plan to invade France?
why is marijuana the most widely used drug?