taylorcard taylorcard

25-10-2016
Mathematics

contestada

to make 5 apple pies you need about 2 pounds fo

to make 5 apple pies you need about 2 pounds fo class=

Respuesta :

GMORELLANA GMORELLANA

25-10-2016

5+5+5+5=20
2+2+2+2=8
8 pounds of apple

Answer Link

Аноним Аноним

25-10-2016

You would need about 8 pounds of apples to make the pies

Answer Link

Otras preguntas

What is the ambiguity technique in literature? A. Sections of a work can be interpreted in more than one way. B. The author’s writing cannot be clearly unders

Wilbur has $800 to open a checking account. He can maintain a minimum balance of at least $500. He plans to use the ATM twice a month and he maintains a savings

DNA tacaggtacccgaacccaattta

In the context of black soldiers in the Union Army, what would be the reason / rationale of fighting for and defending a country that one may argue does not res

16) Which of the following was the most dangerous for prisoners in Andersonville Prison during the Civil War? Question 16 options: torture by Confederate g

Changing a river into a lake is basically what a large dam does. One reason we do this to create reservoirs of fresh water. What is another positive reason to b

T or F...Napoleon Bonaparte was considered one of the best military leaders in history.

What the number is ؟

An ecologist counts 75 cardinals in an area measuring 15 square kilometers. What is the population density of the cardinals?

What analyzes the meaning of this metaphor in the cat and the moon? And the nearest kin of the moon The creeping cat looked up