annaleedewald annaleedewald

24-11-2020
Mathematics

contestada

One-third of a number t is equal to 7 written

Respuesta :

Zeldabeast2009 Zeldabeast2009

24-11-2020

Answer:

idk sorry

Step-by-step explanation:

im really sorry

Answer Link

Otras preguntas

7- What types of RNA are present in a cell and how can you selectively make copies of only the mRNAs?

Which lines from “The Raven” by Edgar Allan Poe show that the speaker has lost hope of ever being able to move on and recover from the pain of losing Lenore?

What two cell types do complement proteins interact with, besides the pathogen itself?

a speech is considered what type of text

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what happened when citric acid and and bicarbonate soda mixed together

Explain lt Explain why the formula for finding the surface area of a rectangular prism is helpful. I NEED HELP !

Pythagorean Theorem: Alex leaves home, travels 5 miles east, and arrives at the library. He leaves the library and travels 3 miles north to a friend's house.

“Just a matter of colouring...or lack of it. It is only a question of getting used to. Who is to say this colour is right and that is not?” Who is the speaker o

A number triple and tripped again is 729 what is the number show workings