khyrag khyrag
  • 26-09-2020
  • English
contestada

What does writing look like, feel like, sound like?​

Respuesta :

YungWop
YungWop YungWop
  • 28-09-2020

Answer:

Like your a teacher

Explanation:

self xp

Answer Link

Otras preguntas

Who envented the ciber truck?
Features of bartering and monetary exchange in ancient China I NEED ONE MORE FEATURE
Which religious groups condemned slavery, beginning in the 1600s? Baptists Puritans Quakers
dont answr ......................................
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA
can i get help pldssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss
what is the implications of these dilemmas in your life as a dtudent,child and members of the community?​
VENbouill....... f. Il boit son café au compt....a.Elle est mu......Complétez avec le suffixe -ète ou -ette.Son état de santé est en n...... amélioration. b. J'
Given that AlHJ is equiangular, find x and y. A. X = 57, y = 54 B. X = 57, y = 63 C. X = 66, y = 54 D. x = 66, y = 55
Free earlobes are determined by a dominant allele. Attached earlobes are determined by a recessive allele. Tyler has free earlobes. His father has free earlobes