Seudónimo Seudónimo
  • 22-09-2020
  • Social Studies
contestada

When do archaeologists believe the first people reached the Monte Verde site in Chile?

Respuesta :

Taylor1231075
Taylor1231075 Taylor1231075
  • 22-09-2020

Answer:

Material evidence gathered at Monte Verde has reshaped the way archaeologists think about the earliest inhabitants of the Americas. Radiocarbon dating has provided a date of 14,800 BP and possibly 33,000 BP, establishing Monte Verde as the oldest-known site of human habitation in the Americas.

Explanation:

Answer Link

Otras preguntas

The secret of good writing is to use sentences that are _____ and _____. A. educated; academic B. complicated; lengthy C. straightforward; simple D.
what is the greenhouse effet. Why is the greenhouse effect so important to life on Earht
Explain how one and two letter chemical symbols are used to identify elements whose names begin with the same letter for example hydrogen and helium ..
how many active muscles are in a human body
What are three reasons why senator Taft opposed U.S involvement in the a North Atlantic treaty?
_______ are publications geared toward audiences made up of people in specific professions.
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
Robert is ordering a pair of boots that cost 59.99 if the sales tax is 7% and shipping is 9.99 what is the total cost
what are causes of prostate cancer
The ________ leader is one who delegates decision making and encourages subordinates to take responsibility.