fareena8074 fareena8074
  • 25-08-2020
  • Mathematics
contestada

85000 nearest to 10,100,1000,10000

Respuesta :

narges8
narges8 narges8
  • 25-08-2020

Answer:

10000

Step-by-step explanation:

85000 is nearest to 10000

Answer Link

Otras preguntas

In a population of skunks, there are striped and stripeless individuals. Stripes are dominant to the absence of stripes. In this population, p = 0.8 and the fre
find three acids and three bases used in your home. 1) what are theses acids and bases used for? 2)look up the chemical name and chemical formula of each acid a
A biological membrane is selectively permeable in that it can, to some extent,control which substances pass through it. Based ont he information provided in Boo
A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair
what happened when citric acid and and bicarbonate soda mixed together
what type of sentence is used to give a command
How many howl ones are equal to 36 quarters
In a population of skunks, there are striped and stripeless individuals. Stripes are dominant to the absence of stripes. In this population, p = 0.8 and the fre
Discussion the following: Compare and contrast 1. a. Niacin b. Folate c. B12 deficiency d. Riboflavin Thank you
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC