jeschange
jeschange
27-04-2020
Mathematics
contestada
How do I simplify b4a5/b6a2
Respuesta :
Samtheman21
Samtheman21
27-04-2020
Anything that is negative goes on the bottom and positive goes on the top b4-b6 is b-2 so we would have negative, just put b2 on the bottom and a3 on the top since a5-a2 is a3. Final solution is a3/b2
Answer Link
VER TODAS LAS RESPUESTAS ( 66+ )
Otras preguntas
Ayuda necesito las nomenclaturas IUPAC, STOCK y TRADICIONAL de:Sn3N2I2OPbSO3Ca(CIO) 2Li2S2O7Be (N O2)2HBrH2SH2TeH Br O3H3P O4H Cl O2
you need to enable fast, easy, and secure transfers of files over long distances on s3. which service would you use?
You should ALWAYS give attribution for any information that you did not create yourself, including images in your visual aids. (T/F)
red incorporated has acquired blue company and recorded goodwill of 280 million as a result. while the fair value of all of blues identifiable tangible and inta
may does not want to go to college nor does she want to get a job, but she has got to do one or the other, according to her parents. she is experiencing which t
It i the tage where the iue are joined in criminal action and without which the proceeding cannot advance further
Analyze the extent to which TWO of the following influenced the development of democracy between 1820 and 1840 Jacksonian Economic Policy Changes in electoral p
How did the mongols create a time of peace, or pax mongolica, despite their violence?
Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul
Patients with which of the following conditions should not take OTC decongestants without first consulting with their doctor?
