luvxmimi luvxmimi
  • 23-04-2020
  • Biology
contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Respuesta :

Аноним Аноним
  • 23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link
StephanyNo StephanyNo
  • 23-04-2020
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Answer Link

Otras preguntas

Name two modern technologies that help us to monitor cyclones.
A softball player leaves the batters box, overruns first base by 3.0 meters, and then returns to first base. Compared to the total distance traveled by the play
Why is it 5 :30 p.m in India and 12 :00 noon in London ?
Identify the domain and rangewith steps please (picture below)
write an equation of the line that passes through the given points:   there are four questions:   1) (0,-1);(6,8)   2) (3,1);(9,7)   3) (1,2);(10,14)   4) (0,0)
if a sum borrowed under compound intrest doubles itsef in 10 years, when will it become four fold?
Why have stone tools survived the best ?
Whats the equivalent fraction to 11/17
Why is it 5 :30 p.m in India and 12 :00 noon in London ?
i know that earth is spinning very fast but why don't we fell  it spinning ?