lb2898
lb2898 lb2898
  • 22-04-2020
  • Biology
contestada

Quick!!
What landform is featured at point A on the map?

Quick What landform is featured at point A on the map class=

Respuesta :

kwesley123 kwesley123
  • 22-04-2020
A river or steam / moving body of water
Answer Link

Otras preguntas

one reason President Johnson created the Great Society program was to
Three differences and one similarity between Shakespeare world and our own
If luisa travel 5 miles west then 8 miles south then 2.5 miles west how far is she from where she started?
6. The probability that a baby will be a boy is ½ as is the probability that a baby will be a girl. Explain this fact by explaining the mechanism of meiosis in
Juliana’s exercise partner is running a high fever and feels nauseous. She also has a rapid heart rate. What should Juliana do? Get warm food Stay in the sun
Which statement is true for single-celled organisms
John Locke would have agreed with all of the following statements EXCEPT:
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
when addressing an envelope for delivery in the united states or canada, the zip code should appear where
​What is the primary way that combination birth control pills work to prevent pregnancy?