natalyromero34 natalyromero34

25-03-2020
Biology

contestada

What which would less likely be a cause of natural selection?

Respuesta :

alecwilkes0 alecwilkes0

25-03-2020

The answer is Evolution.

Answer Link

asia1818 asia1818

25-03-2020

Answer: is Evolution

Answer Link

Otras preguntas

1. A skydiver carries a buzzer which emits a steady 1800 Hz tone. A friend on the ground (directly below the skydiver) listens to the doppler shifted frequency.

Of the following government types, which two have the most in common? A. a democracy and a dictatorship B. a republic and a monarchy C. a republic and an aristo

How far above the bottom of the tank could a second hole be cut so that the stream emerging from it could have the same range as for the first hole

Pls help I have to find the area

if -4/3y is = -3/4 then y =

How did the events of September 11, 2001, transform the world? How might these events have affected the movement toward equality and freedom for all?

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid

Which is the graph of the function y = 3x?

How does carbon cycle through Earth's systems? A. As fossil fuels are burned, carbon dioxide is made available for photosynthesis in animal cells. When the anim

A rectangle and a vertical line are shown. If the rectangle is revolved about the vertical line, what is the resulting object? a rectangle with one side against