ewalumartin ewalumartin
  • 23-09-2019
  • Social Studies
contestada

a correlation tells us ​

Respuesta :

episodecandy2
episodecandy2 episodecandy2
  • 23-09-2019

Answer:

show how strongly pairs of variables are relate

Answer Link
Yaira3456
Yaira3456 Yaira3456
  • 23-09-2019

Answer:

Explanation:Correlation is a statistical technique that can show whether and how strongly pairs of variables are related. For example, height and weight are related; taller people tend to be heavier than shorter people. The relationship isn't perfect.

Answer Link

Otras preguntas

Which of the following statements correctly uses the distributive property? -2(15 - 3) = -2(15) + (-2)(3) 7(9 - 8) = 7(9) - 8 9(-7 + 6) = 9(-7) + 9(6) -3(12 + 5
could someone help me with this also please <3
What is the simplest form of
find possible lenth and breadth of the rectangle whose area is given by the expression x power 2 +6x +8
The essential resources used by early peoples were a. water, animals, and fertile land. C. copper, gold, and fertile land. b. water, copper, and animals. d. iro
AP Physical problem the wording is really throwing me off and im totally lost on how to do this. I would love some help please and thank you! ​
Devaughn is 15 years younger than sydney. the sun of their ages is 63. what is sydney’s age?
Why are polyatomic called radicals
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
Why did the KKK burn crosses