bri044 bri044
  • 23-08-2019
  • Mathematics
contestada

solve for the variable r

solve for the variable r class=

Respuesta :

jimrgrant1 jimrgrant1
  • 23-08-2019

Answer:

see explanation

Step-by-step explanation:

Given

V = πr²h ( isolate r² by dividing both sides by πh )

[tex]\frac{V}{h\pi }[/tex] = r² ( take the square root of both sides )

[tex]\sqrt{\frac{V}{h\pi } }[/tex] = r

Answer Link

Otras preguntas

Who is Satan. WHo is Cameron Mills?
20 points! please help
Lydia applied for the salesperson examination in January 2014. She sat for the exam three times in 2014 and four times in 2015. Each time, Lydia did not receive
Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq
Balance can be achieved even when the two sides of the composition lack symmetry, if they seem to possess the same visual weight. The type of composition is cal
Some people in a hotel are dropping water balloons from their open window on to the ground below. The balloons take 0.15 s to pass your 1.6-m-tall window. Where
What were some effects of European imperialism on Asia?
Two boys, ages 3 and 4, are playing with cars, and both boys want the bigger red car. As the first boy reaches for the red car, the second boy strikes him, knoc
How were members of this religion treated in Illinois?
"Thank You, M'am" and "The Strangers That Came to Town" both address the topic of judging someone by their appearance. Which statement best explains how this to