amberbrown2101 amberbrown2101
  • 26-04-2019
  • Biology
contestada

which describes the variable that is changed to test the prediction?

Respuesta :

Аноним Аноним
  • 14-11-2019

Answer:

a

Explanation:

Answer Link
keelyroo52172 keelyroo52172
  • 16-01-2020

Answer:

independent

Explanation:

Answer Link

Otras preguntas

There are three apple orchards. Each orchard has a different number of trees and apples. Orchard Apple Trees Total Apples --------------------------------------
Bakit minsan ay natutuon lamang ang pansin ng marami sa kasinungalingan bilang paglabag sa katotohanan? ​
After all of the account balances have been extended to the Income Statement columns of the work sheet, the totals of the Debit and Credit columns are $74,440 a
What are biofertilisiers​
A Rosa/ perder/ las llaves
Epd445 was allegedly caught texting 57 minors but 21 of them turned out to be of age. What is the total amount of minors he was allegedly caught texting with?
dia's Ganges River, a vital natural resource, is thought to be seriously contaminated. Why has the government been slow in cleanup efforts?
Pretest: Unit 5 Question 12 of 21 Use the substitution method to solve the system of equations. Choose the correct ordered pair. y = -2x+11 Y = -3x+21​
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
ano ang area ng isang maliit na parisukat​