tatimelo tatimelo
  • 24-10-2018
  • Mathematics
contestada

Simplify this expression 5(6x)

Respuesta :

pahalsehgal pahalsehgal
  • 24-10-2018

30x! That was simple! Steps are shown below in case you need them!

5(6x)

(Now, you multiply 5*6)

30x

Bam!

$30x$

30x is da answer.

Hope that helps! Be sure to let me know if it does not!

Answer Link
emmajeancampbell
emmajeancampbell emmajeancampbell
  • 24-10-2018

Answer:

30x

Step-by-step explanation:

Distributive property, multiply 5 by 6x

this equals 30 add the x

Hope this helps

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
blank thousands equals 1800 tens
what the decimal of 2 1/4
In a monohybrid cross, F2 refers to __________. A)the original mating pair B)the grandparents of the 1st generation C)the 1st filial generation D)the second fil
Tensile strength of a wound is directly related to the
if an element has more than one ionic change how is that piece of information represented in the chemical name
if an element has more than one ionic change how is that piece of information represented in the chemical name
the sale price of a bicycle is $120 this is 75% of the original price find the original price
If you drink a soda with sugar, what happens to your blood glucagon levels?
What domain did sues rule?