laurenlin202 laurenlin202
  • 22-09-2017
  • Mathematics
contestada

How do you do this word problem?

How do you do this word problem class=

Respuesta :

AnimeBrainly
AnimeBrainly AnimeBrainly
  • 22-09-2017
3 x 0.66 = 2
3 + 2 = 5
5 x 2 = 10 (for the one half)


10 exercises i believe is your answer

hope this helps
Answer Link

Otras preguntas

Whose image will replace Andrew Jackson on the U.S. 20$ bill
which of the following are solutions to the equation below? check all that apply. x^2+6x+9=6 A. x=3+√6 B. x=3-√6 C. x=3 D. x=0 E. x=-3+√6 F. x= -3-√6
When parietal cells secrete protons into the stomach, what would you predict would happen to the pH of the blood? Would this process be affected if you treated
Which prefix means 1/10 of a unit in the metric system
If you drink a soda with sugar, what happens to your blood glucagon levels?
Becca had 13/15 of a yard of ribbon to use for her crafts projects. She used 3/7 of a yard to make a bow. How much ribbon, r, does Becca have left? Set up an e
state one reason of magazines has negative impact on individual right in a democratic society
suppose you were to grind the up and homogenate a pancreas. Do you think it would be possible to isolate insulin from this homogenate?
blank thousands equals 1800 tens
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC