irahetalizy1 irahetalizy1
  • 26-03-2024
  • Mathematics
contestada

if the average daily balance for the last month was 940. the finance charger was 11.24 what was the apr

Respuesta :

Otras preguntas

what is an horned lizard
Which is a service industry job that a middle-class person most likely would have had in the early 1900s? farmer bank clerk factory worker railroad worker
PLEASE ANSWER! WILL GIVE BRAINLIEST AND POINTS! The images shown in the two pictures below represent what? The metallurgy of the Egyptians and the Mayans The cu
The story’s conflict begins in which stage of plot? climax falling action exposition rising action
Harvey the wonder hamster can run 3\dfrac16 \text{ km}3 6 1 ​ km3, start fraction, 1, divided by, 6, end fraction, space, k, m in \dfrac14 4 1 ​ start fraction,
What supported the enlightenment idea that people are naturally selfish
What is the free body for the platform
which of these molecules has an overall dipole movement
DNA tacaggtacccgaacccaattta
50 points please help asap is survival and vacate synonyms or antonyms or the words dont have a relationship or they share a cause and effect relationship need